BUY THIS BOOK
Add to Cart

Print Book $39.95


Add to Cart

PDF $27.99

Safari Books Online

What is this?

Add to UK Cart

Print Book £28.50

What is this?

Looking to Reprint or License this content?


Beginning Perl for Bioinformatics
Beginning Perl for Bioinformatics

By James Tisdall
Book Price: $39.95 USD
£28.50 GBP
PDF Price: $27.99

Cover | Table of Contents | Colophon


Table of Contents

Chapter 1: Biology and Computer Science
One of the most exciting things about being involved in computer programming and biology is that both fields are rich in new techniques and results.
Of course, biology is an old science, but many of the most interesting directions in biological research are based on recent techniques and ideas. The modern science of genetics, which has earned a prominent place in modern biology, is just about 100 years old, dating from the widespread acknowledgement of Mendel's work. The elucidation of the structure of deoxyribonucleic acid (DNA) and the first protein structure are about 50 years old, and the polymerase chain reaction (PCR) technique of cloning DNA is almost 20 years old. The last decade saw the launching and completion of the Human Genome Project that revealed the totality of human genes and much more. Today, we're in a golden age of biological research—a point in human history of great medical, scientific, and philosophical importance.
Computer science is relatively new. Algorithms have been around since ancient times (Euclid), and the interest in computing machinery is also antique (Pascal's mechanical calculator, for instance, or Babbage's steam-driven inventions of the 19th century). But programming was really born about 50 years ago, at the same time as construction of the first large, programmable, digital/electronic (the ENIAC ) computers. Programming has grown very rapidly to the present day. The Internet is about 20 years old, as are personal computers; the Web is about 10 years old. Today, our communications, transportation, agricultural, financial, government, business, artistic, and of course, scientific endeavors are closely tied to computers and their programming.
This rapid and recent growth gives the field of computer programming a certain excitement and requires that its professional practitioners keep on their toes. In a way, programming represents procedural knowledge—the knowledge of how to do things—and one way to look at the importance of computers in our society and our history is to see the enormous growth in procedural knowledge that the use of computers has occasioned. We're also seeing the concepts of computation and algorithm being adopted widely, for instance, in the arts and in the law, and of course in the sciences. The computer has become the ruling metaphor for explaining things in general. Certainly, it's tempting to think of a cell's molecular biology in terms of a special kind of computing machinery.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
The Organization of DNA
It's necessary to review some of the very basic concepts and terminology of DNA and proteins at this point. This review is for the benefit of the nonbiologist; if you're a biologist you can skip the next two sections.
DNA is a polymer composed of four molecules, usually called bases or nucleotides. Their names and one-letter abbreviations are adenine (A), cytosine (C), guanine (G), and thymine (T). (See Chapter 4 for more about how DNA is represented as computer data.) The bases joined end to end to form a single strand of DNA.
In the cell, DNA usually appears in a double-stranded form, with two strands wrapped around each other in the famous double helix shape. The two strands of the double helix have matching bases, known as the base pairs. An A on one strand is always opposite a T on the other strand, and a G is always paired with a C.
There is also an orientation to the strands. One end of a nucleotide is called the 5' (five prime) end, and the other is called the 3' (three prime) end. When nucleotides join to make a single strand of DNA, they always connect the 5' end of one to the 3' end of the other. Furthermore, when the cell uses the DNA, as in transcribing it to RNA, it does so base by base from the 5' to the 3' direction. So, when DNA is written, it's done so left to right on the page, corresponding to the 5' to 3' orientation of the bases. An encoded gene can appear on either strand, so it's important to look at both strands when searching or analyzing DNA.
When two strands are joined in a double helix (as in Figure 1-1), the two strands have opposite orientations. That is, the 5' to 3' orientation of one strand runs in an opposite direction as the 5' to 3' orientation of the other strand. So at each end of the double helix, one strand has a 3' end; the other has a 5' end.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
The Organization of Proteins
Proteins are somewhat similar to DNA. They are also polymers, long strings made up of a small number of simple molecules. As DNA is composed of four nucleotides, so proteins are composed of 20 amino acids. These amino acids may occur in any order. See Table 4-2 for the names and one- and three-letter abbreviations for the amino acids.
Amino acids are composed of an amino group, a carboxyl group and a sidechain. They form a chemical bond, called a peptide bond, between the amino group and the carboxyl group of adjacent amino acids. Each of the 20 amino acids has a different sidechain, which protrudes from the backbone. The chemical properties of the sidechains are important in determining the properties of the protein.
Proteins usually have a more complex 3D structure than DNA. The peptide bonds have a great deal of rotational freedom, which allows proteins to form many 3D structures. Instead of DNA's double helix, proteins tend to fold up in a variety of different shapes and are composed of one or more strands of amino acids assembled together. The sequence of amino acids along the strand is called the primary structure. The coiling in on itself into local structures such as helices, beta-strands, and turns, is called the secondary structure. The final foldings and assemblies are called the tertiary and quaternary structure of proteins (see Chapter 11).
There is more primary sequence data available than secondary or higher structural data. In fact, a great deal of primary protein sequence data is available (since it is relatively easy to identify primary protein sequence from DNA, of which a great deal has been sequenced).
The Protein Data Bank (PDB) contains structural information about thousands of proteins, the accumulated knowledge of decades of work. We'll look at the PDB in Chapter 10, but you may want to get a headstart by visiting the PDB web site (
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
In Silico
Recently, the new term in silico has become a common reference to biological studies carried out in the computer, joining the traditional terms in vivo and in vitro to describe the location of experimental studies.
For nonbiologists, in vitro means "in glass," that is, in the test tube; in vivo means "in life," that is, in a living organism. The term in silico stems from the fact that most computer chips are made primarily of silicon. Personally, I prefer a term such as in algorithmo, since there are plenty of ways to compute that don't involve silicon, such as the intriguing processes of DNA computing, quantum computing, optical computing, and more.
The large amount of biological data available online has brought biological research to a situation somewhat similar to physics and astronomy. Those sciences have found that experiments in modern equipment produce huge amounts of data, and the computer isn't only invaluable but necessary for exploring the data. Indeed, it's become possible to simulate experiments entirely in the computer. For instance, an early use of computer simulation in physics was in modeling the acoustics of a concert hall and then experimenting with the results by changing the design of the hall—clearly a much cheaper way to experiment than by building dozens of concert halls!
A similar trend has been occurring in biology since computers were first invented, but this trend has sharply accelerated in recent years with the Human Genome Project and the sequencing of the DNA of many organisms. The experimental data that has to be collected, searched, and analyzed is often far too large for the unaided biologist, who is now forced to rely on computers to manage the information.
Beyond the storage and retrieval of biological data, it's now possible to study living systems through computer simulation. There are standard and accepted studies done routinely on computers that access the genes of humans and of several other organisms. When the sequence of some DNA is determined, it can be stored in the computer, and programs can be written to identify restriction sites, perform restriction digests and create restriction maps (see Chapter 9). Similarly, gene-finding programs can take sequenced DNA and identify putative exons and introns. (Not perfectly, as of this writing, and results differ for different organisms.) Models of cellular processes exist in which it is possible to study for example, the effect of a change in the regulation of a gene.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Limits to Computation
Some of the most interesting results of computer science demonstrate certain limits to human knowledge. There are many open problems in biology, and one hopes that applying more computer power to them may help solve them. But this isn't always possible, because some problems can be shown to be unsolvable; that is, they can't be solved by any program. Furthermore, some problems may be solvable, but as the size of the problem grows, they get practically impossible to solve. These problems are called intractable , or NP-complete. Even a million computers, each a million times more powerful than the most powerful computer existing today, could take perhaps a billion years to compute the answer to such an intractable problem.
Now the chances are that you're not going to get stung by an unsolvable or intractable problem. It can happen, but it's relatively rare. I mention them more as a point of interest than as a practical concern to the beginning programmer. But as you attempt more complex programs down the road, these limitations, and especially the intractable nature of several biological problems, can have a practical impact on your programming efforts.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Chapter 2: Getting Started with Perl
Perl is a popular programming language that's extensively used in areas such as bioinformatics and web programming. Perl has become popular with biologists because it's so well-suited to several bioinformatics tasks.
Perl is also an application, just like any other application you might install on your computer. It is available (at no cost) and runs on all the operating systems found in the average biology lab (Unix and Linux, Macintosh, Windows, VMS, and more). The Perl application on your computer takes a Perl language program (such as one of the programs you will write in this book), translates it into instructions the computer can understand, and runs (or "executes") it.
So, the word Perl refers both to the language in which you will write programs and to the application on your computer that runs those programs. You can always tell from context which meaning is being used.
Every computer language such as Perl needs to have a translator application (called an interpreter or compiler) that can turn programs into instructions the computer can actually run. So the Perl application is often referred to as the Perl interpreter, and it includes a Perl compiler as well. You will often see Perl programs referred to as Perl scripts or Perl code. The terms program, application, script, and executable are somewhat interchangeable. I refer to them as "programs" in this book.
A nice thing about Perl is that you can learn to write programs fairly quickly; in essence, Perl has a low learning curve. This means you can get started easily, without having to master a large body of information before writing useful programs.
Perl provides different styles of writing programs. Since these are beyond the scope of this book, I won't go into details, except to mention the popular style called imperative programming that you'll learn in this book. The equally popular style called object-oriented programming is also well-supported in Perl. Other styles of programming include functional programming and logic programming.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
A Low and Long Learning Curve
A nice thing about Perl is that you can learn to write programs fairly quickly; in essence, Perl has a low learning curve. This means you can get started easily, without having to master a large body of information before writing useful programs.
Perl provides different styles of writing programs. Since these are beyond the scope of this book, I won't go into details, except to mention the popular style called imperative programming that you'll learn in this book. The equally popular style called object-oriented programming is also well-supported in Perl. Other styles of programming include functional programming and logic programming.
Although you can get started quickly, learning all of Perl will certainly take awhile, if that's your goal. Most people learn the basics, as presented in this book, and then learn additional topics as needed.
Let's get a few elementary definitions out of the way:
What is a computer program?
It's a set of instructions written in a particular programming language that can be read by the computer. A program can be as simple as the following Perl language program to print some DNA sequence data onto the computer screen:
print 'ACCTGGTAACCCGGAGATTCCAGCT';
The Perl language programs are written and saved in files, which are ways of saving any kind of data (not only programs) on a computer. Files are organized hierarchically in groups called folders on Macintosh or Windows systems or directories in Unix or Linux systems. The terms folder and directory will be used interchangeably.
What is a programming language?
It's a carefully defined set of rules for how to write computer programs. By learning the rules of the language, you can write programs that will run on your computer. Programming languages are similar to our own natural, or spoken languages, such as English, but are more strictly defined and specific to certain computer systems. With a little bit of training, it's not difficult to read or write computer programs. In this book you'll write in Perl; there are many other programming languages.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Perl's Benefits
The following sections illustrate some of Perl's strong points.
Computer languages differ in which things they make easy. By "easy" I mean easy for a programmer to program. Perl has certain features that simplifies several common bioinformatics tasks. It can deal with information in ASCII text files or flat files, which are exactly the kinds of files in which much important biological data appears, in the GenBank and PDB databases, among others. (See the discussion of ASCII in Chapter 4; Genbank and PDB are the subjects in Chapter 10 and Chapter 11.) Perl makes it easy to process and manipulate long sequences such as DNA and proteins. Perl makes it convenient to write a program that controls one or more other programs. As a final example, Perl is used to put biology research labs, and their results, on their own dynamic web sites. Perl does all this and more.
Although Perl is a language that's remarkably suited to bioinformatics, it isn't the only choice nor is it always the best choice. Other programming languages such as C and Java are also used in bioinformatics. The choice of language depends on the problem to be programmed, the skills of the programmers, and the available system.
Another important benefit of using Perl for biological research is the speed with which a programmer can write a typical Perl program (referred to as rapid prototyping). Many problems can be solved in far fewer lines of Perl code than in C or Java. This has been important to its success in research. In a research environment there are frequent needs for programs that do something new, that are needed only once or occasionally, or that need to be frequently modified. In Perl, you can often toss such a program off in a few minutes or a few hours work, and the research can proceed. This rapid prototyping ability is often a key consideration when choosing Perl for a job. It is common to find programmers familiar with both Perl and C who claim that Perl is five to ten times faster to program in than C. The difference can be critical in the typical understaffed research lab.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Installing Perl on Your Computer
The following sections provide pointers for installing Perl on the most common types of computer systems.
Many computers—especially Unix and Linux computers—come with Perl already installed. (Note that Unix and Linux are essentially the same kind of operating system; Linux is a clone, or functional copy, of a Unix system.) So first check to see if Perl is already there. On Unix and Linux, type the following at a command prompt:
$ perl -v
If Perl is already installed, you'll see a message like the one I get on my Linux machine:
This is perl, v5.6.1 built for i686-linux

Copyright 1987-2001, Larry Wall

Perl may be copied only under the terms of either the Artistic License or the
GNU General Public License, which may be found in the Perl 5 source kit.

Complete documentation for Perl, including FAQ lists, should be found on
this system using 'man perl' or 'perldoc perl'.  If you have access to the
Internet, point your browser at http://www.perl.com/, the Perl Home Page.
If Perl isn't installed, you'll get a message like this:
perl: command not found
If you get this message, and you're on a shared Unix system at a university or business, be sure to check with the system administrator, because Perl may indeed be installed, but your environment may not be set to find it. (Or, the system administrator may say, "You need Perl? Okay, I'll install it for you.")
On Windows or Macintosh, look at the program menus, or use the find program to search for perl. You can also try typing perl -v, at an MS-DOS command window or at a shell window on the MacOS X. (Note that the MacOS X is a Unix system!)
If you don't have Internet access, you can take your computer to a friend who has access and connect long enough to install Perl. You can also use a Zip drive or burn a CD from a friend's computer to bring the Perl software to your computer. There are commercial shrink-wrapped CDs of Perl available from several sources (ask at your local software store) and several books such as O'Reilly's
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
How to Run Perl Programs
The details of how to run Perl vary depending on your operating system. The instructions that come with your Perl installation contain all you need to know. I'll give short summaries here, just enough to get you started.
On Unix or Linux, you usually run Perl programs from the command line. If you're in the same directory as the program, you can run a Perl program in a file called this_program by typing perl this_program. If you're not in the same directory, you may have to give the pathname of the program, for example:
 perl /usr/local/bin/this_program
Usually, you set the first line of this_program to have the correct pathname for Perl on your system, because different machines may have installed Perl in different directories. On my computer, I use the following as the first line of my Perl programs:
#!/usr/bin/perl
You can type which perl to find the pathname where Perl is installed on your system.
You can make the program executable using the chmod program: for instance, you can type:
chmod 755 this_program
If you've set the first line correctly and used chmod, you can just type the name of the Perl program to run it. So, if you're in the same directory as the program, you can type ./this_program. If the program is in a directory that's included in your $PATH or $path variable, you can type this_program.
If your Perl program doesn't run, the error messages you get from the shell in the command window may be confusing. For instance, the bash shell on my Linux system gives the error message:
bash: ./my_program: No such file or directory
in two cases: if there really is no program called my_program in the current directory or if the first line of my_program has incorrectly given the location of Perl. Watch for that, especially when running programs from CPAN (see Appendix A), which may have different pathnames for Perl embedded in their first lines. Also, if you type
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Text Editors
Now that you've set up your computer and installed Perl, you need to select and learn the basics of a text editor. A text editor is used to type documents, such as programs, and to save the contents of those documents into files. So to write a Perl program, you need to use a text editor. This can be a medium-sized learning job if you have never used an editor before, although some text editors are easy to learn. Here are some examples of the most popular editors, arranged by operating-system type:
Unix or Linux
vi and emacs are complex (but very good) editors. pico, xedit, and several others (nedit, gedit, kedit) are easy to use and simple to learn but less powerful. There is also a free, Microsoft Word-compatible editor included in StarOffice (but be sure to save your files as ASCII or text-only).
Macintosh
The built-in editor that comes with MacPerl is fine. There is also a nice commercial editor called BBEdit that is optimized for Perl, as well as a freeware version called BBEdit Lite. You can also use the Alpha shareware editor or Microsoft Word (be sure to save as ASCII text only).
Windows
Notepad works satisfactorily and may already be familiar; Microsoft Word is also usable, but always save as ASCII or text-only. Emacs on Windows is highly recommended for Perl programming on Windows-based computers, but it's a little complicated to learn. There are many other editors as well; I use a free version of the Unix editor vi called vim that has been ported to Windows.
Many other text editors are available. Most computers come with a choice of several editors. (Many programmers try their hand at writing an editor or extending an already existing editor at some point in their careers, so the choices are truly legion.)
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Finding Help
Make sure you have the necessary documentation. If you installed Perl as outlined earlier, documentation is installed as part of the general Perl installation, and the instructions that come with your Perl distribution explain how to get the documentation. There is also excellent online documentation; look for it at the Perl home page.
Programming resources are places to look for answers to programming questions. Perl resources are essential to doing Perl programming. Check out Appendix A to learn where to find resources such as books, online documentation, working programs, newsgroups, archives, journals, and conferences.
As you get involved in programming, you will learn the most important books, web sites, Internet newsgroups and their searchable archives, local gurus (experts in the subject at hand), and program documentation. This includes programming manuals (printed or online) and frequently asked question (FAQs).
Most languages have a standard document set that includes the whole story about the language definition and use. Perl's is included with the program as the online manual. Although programming manuals often suffer from poor writing, it's best to be prepared to dig into them. A well-honed ability to skim is a great asset. The Perl manual isn't bad; its main problem is that, as with most manuals, all the details are there, so it can be a bit overwhelming at first. However, the Perl documentation does a decent job of helping the beginner navigate, by means of tutorial documents.
Finally, I urge you, the beginning programmer, to find some experienced Perl programmer who can answer the occasional question. This may be your teacher or teaching assistant in a course, a coworker, someone down at the local computer store, or someone replying to your posting on an online newsgroup (there are newsgroups specifically for Perl beginners). Chances are that an occasional conversation with an experienced user can save you many hours of chasing deadends during your initial learning stages. Many programmers are happy to lend a hand or offer advice to beginners, there's a friendly and collegial atmosphere that prevails in the programming community.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Chapter 3: The Art of Programming
This chapter provides an overview of how programmers accomplish their jobs. If you already have Perl installed, and you want to get started writing programs for bioinformatics, feel free to skip ahead to Chapter 4.
Just as visitors to a biology lab tend to have a clueless awe of "all those test tubes," so the newcomer to programming may regard the world of the programmer as a kind of arcane black box full of weird terminology and abstruse skills. So, to make the whole enterprise a little more congenial, let's take a short tour of some important realities that affect all programmers. Two of the most important are practical strategies that good programmers use and where to go to find answers to questions that arise while you are programming. Using a couple of brief narrative case studies, we'll look at how programmers find solutions to problems. Appendix A lists some of the best Perl and bioinformatics resources to help you solve your particular problems.
What's the best way to learn programming? The answer depends on what you hope to accomplish. There are several ways to get started. You can:
  • Take classes of many different kinds
  • Read a tutorial book like this one
  • Get the programming manuals and plunge in
  • Be tutored by a programmer
  • Identify a program you need
  • Try any and all of the above until you've managed to write the program
The answer also depends on how you choose to learn. Some people prefer classes, because the information is often presented in a well-organized way, and questions can be answered by the teacher. Others learn best with self-paced study.
Some things about learning to program are common to all these approaches. If you've never programmed at all, the information in the following sections is a "heads-up" about what's ahead.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Individual Approaches to Programming
What's the best way to learn programming? The answer depends on what you hope to accomplish. There are several ways to get started. You can:
  • Take classes of many different kinds
  • Read a tutorial book like this one
  • Get the programming manuals and plunge in
  • Be tutored by a programmer
  • Identify a program you need
  • Try any and all of the above until you've managed to write the program
The answer also depends on how you choose to learn. Some people prefer classes, because the information is often presented in a well-organized way, and questions can be answered by the teacher. Others learn best with self-paced study.
Some things about learning to program are common to all these approaches. If you've never programmed at all, the information in the following sections is a "heads-up" about what's ahead.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Edit—Run—Revise (and Save)
The most important thing about programming is that it's a hands-on learning activity such as dancing, playing music, cooking, or some other family-oriented activity. You can read about it, but you can't actually do it until you actually do it.
While learning to program in Perl, you need to read about how Perl works, as you will in the chapters that follow. You also need to look at plenty of examples of programs. But you especially need to attempt to write your own programs, as you are asked to do in the exercises at the end of the later chapters. Only this kind of direct experience will make you a programmer.
So I want to give you an overview of the most important tasks involved in writing programs, to help you approach your first programs with a clearer idea of what's really involved.
What exactly will you be doing at the computer? The bulk of a programmer's work involves the steps of writing or revising a program in an editor, then running the program and watching how it behaves, and on the basis of that behavior going back and revising the program again. A typical programmer spends more than half of his or her time editing the program.
Once you have even a few lines of code written, it's important to save it. In fact, you should always remember to save a version of your program at regular intervals during editing, so if you make a bunch of edits and the computer crashes, you don't lose hours of work. Also, make sure you back up your work on another disk. Hard disks fail, and when yours does, the information on it will be lost. Therefore it's essential to make regular (daily) backups of your work onto some other medium—tape, floppy disk, Zip disk, another hard disk, writable CD—whatever, just so you won't lose all your work if a disk failure occurs.
In addition to backups of your disks, it's also a good idea to save a dated version of your program at regular intervals. This will allow you to go back to an earlier version of your program should that prove necessary.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
An Environment of Programs
Programming is an exercise in problem solving. It's an iterative, gradual process. Although it can be done by one person alone, it's often a social activity (this surprises many newcomers). It requires developing specific problem-solving skills and learning a few tools. Programming is sometimes tricky and can be frustrating. On the other hand, for those with an aptitude, there's a great sense of satisfaction that comes from building a working program.
Computer programs can be many things, from barely useful, to aesthetically and intellectually stimulating, to important generators of new knowledge. They can be beautiful. (They can also be destructive, stupid, silly, or vicious; they are human creations, after all.) Because writing a program is an iterative, building, gradual process, there can be real satisfaction in seeing the work unfold from simple beginnings to complete structures. For the beginning student, this gradual unfolding of a new program mirrors the gradual mastery of the language.
As our culture began writing and accumulating programs in the middle of the 20th century, a programming environment began to develop. Gradually, we've been accumulating a substantial body of procedural knowledge. Programs often reflect the fact that they swim in waters populated by many other programs, and beginning programmers can expect to learn a lot from this environment.
As programming has become important in the world, it has also become economically valuable. As a result, the source code for many programs is kept hidden to protect commercial assets and stymie the competition.
However, the source code for many of the best and most used programs are freely available for anyone to examine. Freely available source code is called open source. (There are various kinds of copyrights that may attach to open source program code, but they all allow anyone to examine the source code.) The open source movement treats program source code in a similar manner to the way scientists publish their results: publicly and open to unfettered examination and discussion.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Programming Strategies
In order to give you, the beginning programmer, an idea of how programming is done, let's see how an experienced programmer goes about solving problems by giving a couple of instructive case studies.
Imagine that you want to count all the regulatory elements in a large chunk of DNA that you just got from the sequencing lab. You're a professional bioinformatics programmer. What do you do? There are two possible solutions: find a program or write one yourself.
It's likely there is already a perfectly good, working, and maybe even free program that does exactly what you need. Very often, you can find exactly what you need on the Web and avoid the cost and expense of reinventing the wheel. This is programming at its best—minimal work for maximal effect. It's the classic case of the experimentalist's adage: a day in the library can save you six months in the lab.
An important part of the art of programming is to keep aware of collections of programs that are available. Then you can simply use the code if it does exactly what you need, or you can take an existing program and alter it to suit your own needs. Of course, copyright laws must be observed, but much is available at no cost, especially to educational and nonprofit organizations. Most Perl module code has a copyright, but you are allowed to use it and modify it given certain restrictions. Details are available at the Perl web site and with the particular modules.
How do you find this wonderful, free, and already existing program? The Perl community has an organized collection of such programming code at the Comprehensive Perl Archive Network (CPAN) web site, http://www.CPAN.org. Try exploring: you'll find it's organized by topic, so it's possible to quickly find, for example, web, statistics, or graphics programs. In our case, you will find the Bioperl module, which includes several useful bioinformatics functions. A module is a collection of Perl code that can be easily loaded and used by your Perl programs.
The most useful kinds of code are convenient libraries or modules that package a suite of functions. These packages offer a great deal of flexibility in creating new programs. Although you still have to program, the job may be only a small fraction of the work of writing the whole program from scratch. For instance, to continue our example of looking for regulatory elements, your search may turn up a convenient module that lists the regulatory elements plus code that takes a list of elements and searches for them in a DNA library. Then all you have to do is combine the existing code, provide the DNA library, and with a little bit of programming, you're done.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
The Programming Process
You've been assigned to write a program that counts the regulatory elements in DNA. If you've never programmed you probably have no idea of how to start. Let's talk about what you need to know to write the program.
Here's a summary of the steps we'll cover:
  1. Identify the required inputs, such as data or information given by the user.
  2. Make an overall design for the program, including the general method—the algorithm—by which the program computes the output.
  3. Decide how the outputs will print; for example, to files or displayed graphically.
  4. Refine the overall design by specifying more detail.
  5. Write the Perl program code.
These steps may be different for shorter or longer programs, but this is the general approach you will take for most of your programming.
First, you need to conceive a plan for how the program is going to work. This is the overall design of the program and an important step that's usually done before the actual writing of the program begins. Programs are often compared to kitchen recipes, in that they are specific instructions on how to accomplish some task. For instance, you need an idea of what inputs and outputs the program will have. In our example, the input would be the new DNA. You then need a strategy for how the program will do the necessary computing to calculate the desired output from the input.
In our example, the program first needs to collect information from the user: namely, where is the DNA? (This information can be the name of a file that contains the computer representation of the DNA sequence.) The program needs to allow the user to type in the name of a datafile, maybe from the computer screen or from a web page. Then the program has to check if the file exists (and complain if not, as might happen, for instance, if the user misspelled the name) and finally open the file and read in the DNA before continuing.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Chapter 4: Sequences and Strings
In this chapter you will begin to write Perl programs that manipulate biological sequence data, that is, DNA and proteins. Once you have the sequences in the computer, you'll start writing programs that do the following with the sequence data:
  • Transcribe DNA to RNA
  • Concatenate sequences
  • Make the reverse complement of sequences
  • Read sequence data from files
You'll also write programs that give information about your sequences. How GC-rich is your DNA? How hydrophobic is your protein? You'll see programming techniques you can use to answer these and similar questions.
The Perl skills you will learn in this chapter involve the basics of the language. Here are some of those basics:
  • Scalar variables
  • Array variables
  • String operations such as substitution and translation
  • Reading data from files
The majority of this book deals with manipulating symbols that represent the biological sequences of DNA and proteins. The symbols used in bioinformatics to represent these sequences are the same symbols biologists have been using in the literature for this same purpose.
As stated earlier, DNA is composed of four building blocks: the nucleic acids, also called nucleotides or bases. Proteins are composed of 20 building blocks, the amino acids, also called residues. Fragments of proteins are called peptides. Both DNA and proteins are essentially polymers, made from their building blocks attached end to end. So it's possible to summarize the structure of a DNA molecule or protein by simply giving the sequence of bases or amino acids.
These are brief definitions; I'm assuming you are either already familiar with them or are willing to consult an introductory textbook on molecular biology for more specific details. Table 4-1 shows bases; add a sugar and you get the nucleotides adenosine, guanosine, cytidine, thymidine, and uridine. You can further add a phosphate and get the nucleotides adenylic acid, guanylic acid, cytidylic acid, thymidylic acid, and uridylic acid. A
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Representing Sequence Data
The majority of this book deals with manipulating symbols that represent the biological sequences of DNA and proteins. The symbols used in bioinformatics to represent these sequences are the same symbols biologists have been using in the literature for this same purpose.
As stated earlier, DNA is composed of four building blocks: the nucleic acids, also called nucleotides or bases. Proteins are composed of 20 building blocks, the amino acids, also called residues. Fragments of proteins are called peptides. Both DNA and proteins are essentially polymers, made from their building blocks attached end to end. So it's possible to summarize the structure of a DNA molecule or protein by simply giving the sequence of bases or amino acids.
These are brief definitions; I'm assuming you are either already familiar with them or are willing to consult an introductory textbook on molecular biology for more specific details. Table 4-1 shows bases; add a sugar and you get the nucleotides adenosine, guanosine, cytidine, thymidine, and uridine. You can further add a phosphate and get the nucleotides adenylic acid, guanylic acid, cytidylic acid, thymidylic acid, and uridylic acid. A nucleic acid is a chemically linked sequence of nucleotides. A peptide is a small number of joined amino acids; a longer chain is a polypeptide. A protein is a biologically functional unit made of one or more polypeptides. A residue is an amino acid in a polypeptide chain.
For expediency, the names of the nucleic acids and the amino acids are often represented as one- or three-letter codes, as shown in Table 4-1 and Table 4-2. (This book mostly uses the one-letter codes for amino acids.)
Table 4-1: Standard IUB/IUPAC nucleic acid codes
Code
Nucleic Acid(s)
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
A Program to Store a DNA Sequence
Let's write a small program that stores some DNA in a variable and prints it to the screen. The DNA is written in the usual fashion, as a string made of the letters A, C, G, and T, and we'll call the variable $DNA. In other words, $DNA is the name of the DNA sequence data used in the program. Note that in Perl, a variable is really the name for some data you wish to use. The name gives you full access to the data. Example 4-1 shows the entire program.
Example 4-1. Putting DNA into the computer
#!/usr/bin/perl -w
# Storing DNA in a variable, and printing it out

# First we store the DNA in a variable called $DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Next, we print the DNA onto the screen
print $DNA;

# Finally, we'll specifically tell the program to exit.
exit;
Using what you've already learned about text editors and running Perl programs in Chapter 2, enter the code (or copy it from the book's web site) and save it to a file. Remember to save the program as ASCII or text-only format, or Perl may have trouble reading the resulting file.
The second step is to run the program. The details of how to run a program depend on the type of computer you have (see Chapter 2). Let's say the program is on your computer in a file called example4-1. As you recall from Chapter 2, if you are running this program on Unix or Linux, you type the following in a shell window:
perl example4-1 
On a Mac, open the file with the MacPerl application and save it as a droplet, then just double-click on the droplet. On Windows, type the following in an MS-DOS command window:
perl example4 -1
If you've successfully run the program, you'll see the output printed on your computer screen.
Example 4-1 illustrates many of the ideas all our Perl programs will rely on. One of these ideas is control flow , or the order in which the statements in the program are executed by the computer.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Concatenating DNA Fragments
Now we'll make a simple modification of Example 4-1 to show how to concatenate two DNA fragments. Concatenation is attaching something to the end of something else. A biologist is well aware that joining DNA sequences is a common task in the biology lab, for instance when a clone is inserted into a cell vector or when splicing exons together during the expression of a gene. Many bioinformatics software packages have to deal with such operations; hence its choice as an example.
Example 4-2 demonstrates a few more things to do with strings, variables, and print statements.
Example 4-2. Concatenating DNA
#!/usr/bin/perl -w
# Concatenating DNA

# Store two DNA fragments into two variables called $DNA1 and $DNA2
$DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
$DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';

# Print the DNA onto the screen
print "Here are the original two DNA fragments:\n\n";

print $DNA1, "\n";

print $DNA2, "\n\n";

# Concatenate the DNA fragments into a third variable and print them
# Using "string interpolation"
$DNA3 = "$DNA1$DNA2";

print "Here is the concatenation of the first two fragments (version 1):\n\n";

print "$DNA3\n\n";

# An alternative way using the "dot operator":
# Concatenate the DNA fragments into a third variable and print them
$DNA3 = $DNA1 . $DNA2;

print "Here is the concatenation of the first two fragments (version 2):\n\n";

print "$DNA3\n\n";

# Print the same thing without using the variable $DNA3
print "Here is the concatenation of the first two fragments (version 3):\n\n";

print $DNA1, $DNA2, "\n";

exit;
As you can see, there are three variables here, $DNA1, $DNA2, and $DNA3. I've added print statements for a running commentary, so that the output of the program that appears on the computer screen makes more sense and isn't simply some DNA fragments one after the other.
Here's what the output of Example 4-2 looks like:
Here are the original two DNA fragments:

ACGGGAGGACGGGAAAATTACTACGGCATTAGC
ATAGTGCCGTGAGAGTGATGTAGTA

Here is the concatenation of the first two fragments (version 1):

ACGGGAGGACGGGAAAATTACTACGGCATTAGCATAGTGCCGTGAGAGTGATGTAGTA

Here is the concatenation of the first two fragments (version 2):

ACGGGAGGACGGGAAAATTACTACGGCATTAGCATAGTGCCGTGAGAGTGATGTAGTA

Here is the concatenation of the first two fragments (version 3):

ACGGGAGGACGGGAAAATTACTACGGCATTAGCATAGTGCCGTGAGAGTGATGTAGTA
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Transcription: DNA to RNA
A large part of what you, the Perl bioinformatics programmer, will spend your time doing amounts to variations on the same theme as Examples 4-1 and 4-2. You'll get some data, be it DNA, proteins, GenBank entries, or what have you; you'll manipulate the data; and you'll print out some results.
Example 4-3 is another program that manipulates DNA; it transcribes DNA to RNA. In the cell, this transcription of DNA to RNA is the outcome of the workings of a delicate, complex, and error-correcting molecular machinery. Here it's a simple substitution. When DNA is transcribed to RNA, all the T's are changed to U's, and that's all that our program needs to know.
Example 4-3. Transcribing DNA into RNA
#!/usr/bin/perl -w
# Transcribing DNA into RNA

# The DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen
print "Here is the starting DNA:\n\n";

print "$DNA\n\n";

# Transcribe the DNA to RNA by substituting all T's with U's.
$RNA = $DNA;

$RNA =~ s/T/U/g;

# Print the RNA onto the screen
print "Here is the result of transcribing the DNA to RNA:\n\n";

print "$RNA\n";

# Exit the program.
exit;
Here's the output of Example 4-3:
Here is the starting DNA:

ACGGGAGGACGGGAAAATTACTACGGCATTAGC

Here is the result of transcribing the DNA to RNA:

ACGGGAGGACGGGAAAAUUACUACGGCAUUAGC
This short program introduces an important part of Perl: the ability to easily manipulate text data such as a string of DNA. The manipulations can be of many different sorts: translation, reversal, substitution, deletions, reordering, and so on. This facility of Perl is one of the main reasons for its success in bioinformatics and among programmers in general.
First, the program makes a copy of the DNA, placing it in a variable called $RNA:
$RNA = $DNA;
Note that after this statement is executed, there's a variable called $RNA that actually contains DNA. Remember this is perfectly legal—you can call variables anything you like—but it is potentially confusing to have inaccurate variable names. Now in this case, the copy is preceded with informative comments and followed immediately with a statement that indeed causes the variable
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Using the Perl Documentation
A Perl programmer's most important resource is the Perl documentation. It should be installed on your computer, and it may also be found on the Internet at the Perl site. The Perl documentation may come in slightly different forms on your computer system, but the web version is the same for everybody. That's the version I refer to in this book. See the references in Appendix A for more discussion about different sources of Perl documentation.
Just to try it out, let's look up the print operator. First, open your web browser, and go to http://www.perl.com. Then click on the Documentation link. Select "Perl's Builtin Functions" and then "Alphabetical Listing of Perl's Functions". You'll see a rather lengthy alphabetical listing of Perl's functions. Once you've found this page, you may want to bookmark it in your browser, as you may find yourself turning to it frequently. Now click on Print to view the print operator.
Check out the examples they give to see how the language feature is actually used. This is usually the quickest way to extract what you need to know.
Once you've got the documentation on your screen, you may find that reading it answers some questions but raises others. The documentation tends to give the entire story in a concise form, and this can be daunting for beginners. For instance, the documentation for the print function starts out: "Prints a string or a comma-separated list of strings. Returns TRUE if successful." But then comes a bunch of gibberish (or so it seems at this point in your learning curve!) Filehandles? Output streams? List context?
All this information is necessary in documentation; after all, you need to get the whole story somewhere! Usually you can ignore what doesn't make sense.
The Perl documentation also includes several tutorials that can be a great help in learning Perl. They occasionally assume more than a beginner's knowledge about programming languages, but you may find them very useful. Exploring the documentation is a great way to get up to speed on the Perl language.
Additional content appearing in this section has been removed.
Purchase this book now or read it online at Safari to get the whole thing!
Calculating the Reverse Complement in Perl
As you recall from Chapter 1, a DNA polymer is composed of nucleotides. Given the close relationship between the two strands of DNA in a double helix, it turns out that it's pretty straightforward to write a program that, given one strand, prints out the other. Such a calculation is an important part of many bioinformatics applications. For instance, when searching a database with some query DNA, it is common to automatically search for the reverse complement of the query as well, since you may have in hand the opposite strand of some known gene.
Without further ado, here's Example 4-4, which uses a few new Perl features. As you'll see, it first tries one method, which fails, and then tries another method, which succeeds.
Example 4-4. Calculating the reverse complement of a strand of DNA
#!/usr/bin/perl -w
# Calculating the reverse complement of a strand of D