
Beginning Perl for Bioinformatics

Errata for Beginning Perl for Bioinformatics

Submit your own errata for this product.

The errata list is a list of errors and their corrections that were found after the product was released. If the error was corrected in a later version or reprint the date of the correction will be displayed in the column titled "Date Corrected".

The following errata were submitted by our customers and approved as valid errors by the author or editor.

Color key: Serious technical mistake Minor technical mistake Language or formatting error Typo Question Note Update

Version Location Description Submitted By Date submitted Date corrected
Page vii

a link to the brain tumors you suspect exist.
a role in tumor development.


Anonymous    Nov 30, 2010
Page ix

metaphor between the two disciplines.)


Anonymous    Nov 30, 2010
Page xi

sequences data
sequence data


Anonymous    Nov 30, 2010
Page vii
-1 ## A reader reports


## This is confirmed.


Anonymous    Jan 01, 2007
Page viii
+1 ## A reader reports


## This is confirmed.


Anonymous    Jan 01, 2007
Page ix

itself or an adjunct to ongoing investigations.
itself, or as an adjunct to ongoing investigations.


Anonymous    Jan 01, 2007
Page ix

This books is
This book is


Anonymous    Jan 01, 2007
Page ix

and the computer program.
and computer programming.


Anonymous    Jan 01, 2007
Page 1

large, programmable, digital/electronic (the ENIAC) computers.
large-scale, programmable, digital, electronic computers (such as ENIAC).


Anonymous    Nov 30, 2010
Page 2

The bases joined end to end to form
The bases are joined end to end to form


Anonymous    Nov 30, 2010
Page 2

it's done so left to right
it's usually written left to right


Anonymous    Nov 30, 2010
Page 2

of DNA and positions

of DNA and proteins

Anonymous    Sep 01, 2004
Page 2

as in translating it to RNA

as in transcribing it to RNA

Anonymous    Sep 01, 2004
Page 3

It can appear as
It can appear in


Anonymous    Nov 30, 2010
Page 3

most of the life
much of the life


Anonymous    Nov 30, 2010
Page 3

Genbank, the Genetic Sequence Data Bank (http://www.ncbi.n/

GenBank, the Genetic Sequence Data Bank (

Anonymous    Sep 01, 2004
Page 3

are composed of an amino group and a carboxyl group.

are composed of an amino group, a carboxyl group, and a sidechain.

Anonymous    Sep 01, 2004
Page 4

easy to identify
easy to calculate the


Anonymous    Nov 30, 2010
Page 4

such as the intriguing processes of
for instance, the intriguing techniques of


Anonymous    Nov 30, 2010
Page 5

related by virtue of their protein products as part of
related by virtue of their protein products being part of


Anonymous    Nov 30, 2010
Page 7

natural, or spoken, languages, such as English
<emphasis>natural languages</emphasis>, such as English

##(NOTE to editors): natural language is not synonomous with spoken language.
## You can speak mathematics, or music, or Perl. You can write English.
## Some natural languages are now only written, such as ancient Egyptian, etc.
## A fine point, I realize, but humor me -- I spent 6 years in speech research,
## and my opinions are ossified ;>). So I <emphasize> it as a technical term, and
## give an immediate example - English.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 9

Mac, then
Mac, and then


Anonymous    Nov 30, 2010
Page 9

Mac OS X


Anonymous    Nov 30, 2010
Page 10

Mac OS X

## two instances of this here


Anonymous    Nov 30, 2010
Page 11
+1 ## A reader reports

several books such as O'Reilly's Perl Resource Kits,
several books

## The reader comments:
## I would suggest to remove "such as O'Reilly's Perl Resource Kits,".
## There is only the Win32 version still available, and even this version
## is totally outdated and much too expensive for the audience of this book.

## Tisdall says: sounds plausible to me: editors, how say you??


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 11
itemized list #1

the that
that the


Anonymous    Nov 30, 2010
Page 14

type /my_program

type ./my_program

Anonymous    Sep 01, 2004
Page 15

Mac OS X


Anonymous    Nov 30, 2010
Page 16

beginners, there's
beginners: there's


Anonymous    Nov 30, 2010
Page 29 + 30

the words "bases", "nucleosides" (see preceding note), and
"nucleotides" should be in italics - these are
important terms


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 30

primary structure


Anonymous    Nov 30, 2010
Page 30

add a sugar and you get the nucleotides
add a sugar and you get the nucleosides


Anonymous    Nov 30, 2010
Page 32

remember that


Anonymous    Nov 30, 2010
Page 33
+2 command example ## A reader reports

perl example4 -1
perl example4-1

## This is confirmed.


Anonymous    Nov 30, 2010
Page 34

Mac OS X


Anonymous    Nov 30, 2010
Page 35

more easily read
more easily readable


Anonymous    Nov 30, 2010
Page 38

and to make sure
and its output to make sure that


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 38

to the right
on the right


Anonymous    Nov 30, 2010
Page 45

new and successful way.
new and successful approach.


Anonymous    Nov 30, 2010
Page 47

You can use any name
You can use any name for the file


Anonymous    Nov 30, 2010
Page 52

You can print the elements one a after
You can print the elements one after


Anonymous    Nov 30, 2010
Page 54

both are listed in
both are demonstrated in


Anonymous    Nov 30, 2010
Page 55
Exercise 4.7

the last line first. Or you may
the last line first. You may


Anonymous    Nov 30, 2010
Page 60

Example 5-2 (from Chapter 4)
Example 5-2 (which modifies Example 4-7)


Anonymous    Nov 30, 2010
Page 61

is assigned each time through the loop to
the next line of the file
is assigned to the next line of the file
each time through the loop


Anonymous    Nov 30, 2010
Page 61

a Microsoft Windows versions
a version of Microsoft Windows


Anonymous    Nov 30, 2010
Page 62

the type of input it gets.
the type of input the program gets.


Anonymous    Nov 30, 2010
Page 63
+2 ## A reader reports

Formats A nd B
Formats A and B

## This is confirmed.


Anonymous    Nov 30, 2010
Page 64

Example 5-3, in Chapter 9, and
Example 5-3; in Chapter 9; and


Anonymous    Nov 30, 2010
Page 66
-3 ## A reader reports

is a scalar variable starts with a dollar sign $)
is a scalar variable (which starts with a dollar sign $)

## This is confirmed.


Anonymous    Nov 30, 2010
Page 66

(as was true in Example 4-3)

(as was true in Example 4-5)

Anonymous    Sep 01, 2004
Page 68

whitespace characters, represented by s with nothing and by the lack of anything between
the second and third forward slashes.
whitespace characters (represented by s) with nothing (represented by the lack of anything between
the second and third forward slashes).


Anonymous    Nov 30, 2010
Page 68

characters, which is done globally
characters. This deletion is done globally


Anonymous    Nov 30, 2010
Page 69
+1 ## A reader reports

line, and a formfeed advances to the next line. The two of them
together amount to the same thing as a newline character.
line. Perl newlines are handled differently on different operating systems;
works on all, but you may see
at the end of lines on Windows.

## This is confirmed.


Anonymous    Nov 30, 2010
Page 72

We now have a design for the program, let's
Now that we have a design for the program, let's


Anonymous    Nov 30, 2010
Page 74

is the same as previous
is the same as in previous


Anonymous    Nov 30, 2010
Page 74
Output from Example 5-4

T = 17

T = 17
errors = 1

Anonymous    Sep 01, 2004
Page 75

decimal or floating-point numbers
decimal (or floating-point) numbers
## italicise "floating-point"


Anonymous    Nov 30, 2010
Page 75


## not 6,544,000 because readers might try inputting numbers to Perl that way


Anonymous    Nov 30, 2010
Page 75
+4 ## A reader reports

(see Chapter 6 and the discussion of my variables)
## omit this parenthesis, it duplicates a remark earlier in the paragraph.

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 75

languages also require you to declare the type of a variable, for example "integer," or
"string," but Perl does not.
languages require you to pre-declare a variable's type (e.g. "integer i"). Perl
indicates the type right in the variable name (e.g. the "@" in "@array").


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 77

This version of the foreach loop:

foreach(@DNA) {.

This version of the foreach loop:

foreach (@DNA) {

Anonymous    Sep 01, 2004
Page 77

in the version of this loop in Example 5-5

in the version of this loop in Example 5-4

Anonymous    Sep 01, 2004
Page 80

or Perl documentation
or the Perl documentation


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 80
+1 (output of Example 5-6)

recognize this vase:

recognize this base:

Anonymous    Sep 01, 2004
Page 81



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 81



Anonymous    Sep 01, 2004
Page 82

reading from, and writing to, files as well as other actions.
reading from files and writing to files, as well as other actions.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 82
+1 (in code fragment)

# Also write the results to a file called "countbase"

$outputfile = "countbase";
unless ( open(COUNTBASE, ">$outputfile") ) {

# Also write the results to a file called "countbase"
$outputfile = "countbase";

unless ( open(COUNTBASE, ">$outputfile") ) {

Anonymous    Sep 01, 2004
Page 82

several other behaviors.

several other behaviors, such as appending to a file.

Anonymous    Sep 01, 2004
Page 84
Second line from top

while($dna =~ /a/ig){$a++}
Should be:
while($DNA =~ /a/ig){$a++}

4th line from top;
$dna =~ /a/ig
should be:
$DNA =~ /a/ig


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 84

also has the global modifier,
also has the global modifier g,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 84

you'll use those while loops to good effect
you'll use while loops in a similar fashion, to good effect


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 84

The program, however,
The program, moreover,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 84
last code

($dna = ~ tr/ACGTacgt//)
($dna =~ tr/ACGTacgt//)
There shouldn't be a space between = and ~


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 85
Exercise 5-1

Mac OS X


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 85
Exercise 5.6; ## A reader reports

The solution to Exercise 5.6 does not find the reverse complement of DNA. If s
hift is substituted for pop in the code, then the reverse complement would be f

However the solution to Exercise 5.6 does not show any output when compiled. P
lease fix the solution to Exercise 5.6, ie include STDIN in the program.

## Tisdall replies:
## This report is incorrect. The exercise determines if the two input
## strings are reverse complements of each other.
## Also, the program does not use STDIN -- it gets its data from the
## command line, and uses @ARGV for that. Here's an example of running
## the program:
#### They ARE reverse complements


Page 85
-1 ## A reader reports

(eq actually an operator).
(eq is actually an operator).

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 86
Exercise 5.9 ## A reader reports

(Hint: you can use the Perl functions substr or slice.
(Hint: you can use the Perl functions substr or splice.)

## This is confirmed


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 86
Exercise 5.10; ## A reader reports

After being compiled and run Exercise 5.10 does not, print the message:

"File $tmpfile does not exists!

Shouldn't the program print this, since the program's purpose is to remove the
tmp file?

## Tisdall replies:
## This report is incorrect. The program does not print any message when
## everything works. Error messages are only printed if something fails
## to work during the program. (Think of it as an error-reporting program.)


Page 87

the mutation of DNA.
the mutation of DNA, and in all the following chapters.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 88

mean of a distribution at
mean of a distribution, at


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 88

so-called recursion
## italicise "recursion"


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 88

The trick of all
The trick to all


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 89

We'll now look at this code
We'll now look more closely at this code


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 90

seen earlier in loops and conditional statements that groups
as the block used in a loop to group


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 91

as in return $dna; in our subroutine addACGT, in a list of scalars as in
return ($dna1, $dna2);, in an array as in return @lines;, and more.
as in return $dna in our subroutine addACGT; in a list of scalars as in
return ($dna1, $dna2); in an array as in return @lines; and more.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 93
+3 code example

my $x ;
my $x;


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 93

such as the my construct.

with the my construct. (Unless you're
using global variables, which we're not.)

Anonymous    Sep 01, 2004
Page 94

You can get by this
You can obtain the


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 96

even though a variable called $dna is lengthened inside the subroutine
even though the value of a variable called $dna is altered inside the subroutine


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 96

You use the command line
You'll also use the command line


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 96

Mac OS X


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 96
+4 code fragment



Anonymous    Sep 01, 2004
Page 97
Subroutines for Example 6-3

# Chapter Four, "Motifs and Loops"
# Chapter Five, "Motifs and Loops"


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 98

as you would any other scalar variables.
as you would any other scalar variable.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 101

In the example of pass-by-reference in this section
In the example of pass-by-reference later in this section


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 102

passed on as arguments.
passed in as arguments.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 102

appear in multiple program.
appear in multiple programs.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 103

Beginning in Chapter 8, I'll define subroutines and show the code, but you'll be
putting them into your module and typing:
All the useful subroutines in this book will be put into this module, which
you'll start using in Chapter 8 by typing:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 107
code example, for each loop, variable name in line 8 of the

loop, middle of the page



Anonymous    Jan 01, 2007
Page 109

step you through that code as well.
steps you through that code as well.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 110

Now that $dna has been declared and initialized, the program seems wrong on the
first statement:
Now that $dna has been declared and initialized, let's see if it's what we expect:
this may be where the program's going wrong, on the first statement!

Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 110
First code section

The paragraph before the code:
"If you wish to see more lines, the w or "window" command will serve"
w adds a watch. It Should be v
"If you wish to see more lines, the v or "window" command will serve"


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 113
First code part

Books states:

DB<12> D
Deleting all breakpoints..

But it should be:
DB<21> B *
Deleting all breakpoints...


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 113
Third debugging code section

DB<13> w 45

Should it be
DB<13> v 45


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 113
Second debugging code section

Book states
DB<12> W $receivingcommittment

But should be w (lowercase)
DB<12> w $receivingcommittment


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 114
2nd paragraph

You see that at line 66 you misspelled

Should be
You see that at line 46 you misspelled


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 115
Last paragraph from bottom

Book states
"So fix the misspelling at line 66"

Should be
"So fix the misspelling at line 46"


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 118

nonviable offspring that dies
nonviable offspring that die


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 118

they can lead to evolutionary
mutations can lead to evolutionary


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 119
last paragraph

the first and last sentences of this paragraph are redundant and one could be cut (I
would recommend cutting the last sentence).

first sentenct: "In the examples that follow, I use a simple Perl Method for seed
picking that's okay for most purposes."

last sentence: "In this book, I use a Perl method that is good enough for most


Note from the Author or Editor:
Error corrected. Will be fixed for next printing.

Anonymous    May 02, 2011
Page 123

is a do-until loop.
is a do-until loop, first seen in Example 5-3.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 123

that do the test first and then the block.
that test first and then do the block.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 124

greater than 0 and less than 7

greater than or equal to 0 and less than 7

Anonymous    Sep 01, 2004
Page 125

a task. the following
a task. The following


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 127

is really a short function
is a very short subroutine


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 127

It's just like the idea in
It's a subroutine to select a string position, very similar to the idea in


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 127

Of course, if you were really writing this code, you'd make a little test to see if your
subroutine worked.
While writing subroutines, you frequently want to write a little test to see if your
subroutine works as you intend:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 129

is a short program.
is a short subroutine.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 129

picking a random position then
picking a random position, then


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 129

have to do that a lot
have to look things up a lot


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 138

main program and proceeds, following the order of the
top-down design you did in pseudocode,
then followed by the subroutines.
main program and is followed by the subroutines,
in the same order as the top-down design you did in pseudocode.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 142

nucleotide in the same position
nucleotides in the same positions


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 146
output example 7-4

is says
matching positions is 0.24%
should say either 24%


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 147
3rd paragraph from the top

(indexed by $K)

should be
(indexed by $k)


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 148
Exercise 7.7; ## A reader reports

Sometimes not all choices are will be picked
Sometimes not all choices are equally likely to be picked

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 149

different data structures (hashes, arrays, and databases) can store

different data structures (like hashes and arrays) and database systems can store

Anonymous    Sep 01, 2004
Page 150

Mathematically, a Perl hash always represents a finite function.
## Take this sentence out of this paragraph, and place it instead
## between the two sentences of the following paragraph.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 152

couldn't respond
couldn't respond informatively


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 152

## Append this at the end of the 2nd paragraph,
## after "missing from your experiment."
(Maybe the user simply mistyped the gene name!)


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 152

You might try storing
You could store


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 153

in an array, for example, to search
in an array. For example, to search


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 155
+1 ## A reader reports

databases. Some good ones that are free
databases, some good ones that are free

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 155

The genetic code is how a cell translates the information contained in its DNA into
amino acids and then proteins, which do the real work in the cell.
The genetic code describes how the information in the <firstterm>coding regions</firstterm>
of DNA is translated into the correct amino acids for the assembly of the cell's proteins.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 155



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 156

the process stops when a codon is encountered.
the process stops when one of the three stop codons is encountered.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 156

the encoding of amino acids
the encoding for amino acids


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 156

The chart in Figure 8-1 shows how the various bases combine to form amino acids.

Figure 8-1 shows each codon and its associated amino acid: the genetic code.

Anonymous    Sep 01, 2004
Page 156

the process stops when a codon is encountered.

the process stops when one of the three stop codons is encountered.

Anonymous    Sep 01, 2004
Page 159

The print statement accepts a filehandle as an optional
argument, but so far, we've been printing to the default STDOUT.
The print statement accepts a filehandle as an optional
argument (as in Example 5-7), but by default prints to STDOUT.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 159

code, and the last subroutine clearly displays this redundancy.
It might be interesting to express that in your subroutine.
code, and subroutine codon2aa clearly maps several codons to the
same amino acid. We can represent this redundancy another way.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 159

let's try to redo the subroutine
let's rewrite subroutine codon2aa


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 160
+3 ## A reader reports

## could be formatted in nonproportional font

## Tisdall says: editors, how say you???


Page 163

the genetic code hash
the genetic_code hash


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 163

subroutine translates a whole DNA sequence
subroutine can be used to translate a whole DNA sequence


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 164
+2 ## A reader reports


## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 165
after second paragraph; ## A reader reports

"$codon = substr ($dna, $i 3);" should be
"$codon = substr ($dna, $i, 3);"

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 166

biologists and programmers invented
biologists and programmers have invented


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 167
7th paragraph

Protein Identification Resource (PIR)
Protein Information Resource (PIR)


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 167

limit them to 80 characters in length.
limit them to at most 80 characters.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 170

would think incorrectly, that the file
would think, incorrectly, that the file


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 171

It's convenient to declare these my variables as $line on the spot,

It's often convenient to declare a loop's "index variable" (like $line)
as a my variable, right on the spot in the loop,

Anonymous    Sep 01, 2004
Page 174

As you accumulate useful subroutines in our modules,
As you accumulate useful subroutines in modules,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 175

where in the DNA you're studying the cell
where, in the DNA you're studying, the cell


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 176
Code for subroutine "revcom"

my($revcom) = reverse($dna);

my $revcom = reverse $dna;

Anonymous    Sep 01, 2004
Page 177

## The equation should be reformatted so that:

+ 1


Anonymous    Dec 01, 2009
Page 177
-1 ## A reader reports

Pseudocode line near the bottom of the page, above last paragraph;
This is pseudocode, so it doesn't have to be perfect, but as written this line
looks like some kind of strange assignment instead of a comparison:

"(end - 1) - (start - 1) + 1 = end - start +1"

I'm not sure what the best way to fix this is. It is set in the monospace font
used for pseudocode & real code, but it isn't quite either, so I was going to s
uggest re-setting it in the variable width font used in the main text. That pro
bably won't clarify it either though, so the equals sign should probably just b
e doubled so that it's clear that the line is a comparison, and not an assignme

## Tisdall replies:
## This report is (kind of) confirmed. The line in question is an
## equation from elementary algebra.
## = as assignment in programming languages, and = as equality
## in algebra and much other mathematics, is indeed confusing
## (and has already been discussed), therefore let me add:

So let's write this subroutine:
as we know from algebra. So let's write this subroutine:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 182
-4 ## A reader reports


## This report is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 184

documentation (or Appendix B), for
documentation (or Appendix B) for


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 187
1st paragraph

for each enzyme.To simplify matters
for each enzyme. To simplify matters


Note from the Author or Editor:
Error corrected. Will fixed in next printing.

Anonymous    May 02, 2011
Page 188

If you have two or three per line that have whitespace and are separated from each
other by whitespace,
We have two or three words per line that are separated from each
other by whitespace,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 188

(which acts on the line as stored in the special variable @_.:
(which by default splits on the line stored in the special variable $_):


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 188

($name, $site) = split(" ")
@fields = split(" ");


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 188

$name = shift@fields;
$site = pop@fields;
$name = shift @fields;
$site = pop @fields;


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 188

the documentation on REBASE you found on its web site
the documentation from the REBASE web site


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 189

Of course, REBASE uses them, because a given restriction enzyme might well match
a few different recognition sites.
Of course, REBASE uses these IUB codes because a given restriction enzyme might well bind
to a few different DNA patterns, varying in one or more bases.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 189

given a string,
given a string of sequence containing IUB codes,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 191
Example 9-2 Subroutine "parseREBASE"

# Read in the REBASE file
@rebasefile = get_file_data($rebasefile);

foreach ( @rebasefile ) {

!!! Should be: !!!

# Read in the REBASE file
my $rebase_filehandle = open_file($rebasefile);

while(<$rebase_filehandle>) {


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 191

You're using a foreach loop to process the lines of the bionet file stored in the
@rebasefile array.

!!! Should be: !!!

You're using a while loop to process the lines of the bionet file as they are
read in from the file using the filehandle called $rebase_filehandle.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 192

evaluates and returns the right.
evaluates the right and returns.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 193

conditionals to their own blocks.
conditionals with their own blocks.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 193

and returns the left argument if it's true; if the left
argument doesn't evaluate to true, it evaluates and returns the right argument.
the left argument and returns if it's true; if the left
argument is false, it evaluates the right argument and returns true or false.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 193

you skip the rest of the loop.
you skip the rest of the block and return to the top of the loop.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 200
+3 ## A reader reports

It's bad, because that same flexibility makes it harder to write programs that to
find and extract the desired annotations.
It's bad, because that same flexibility makes it harder to write programs that
find and extract the desired annotations.

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 203

contains 12,813516 loci and


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 204

over 8 trillion
over 8 billion


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 205

with each appearing as an element
with each line of the file appearing as an element


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 205

this datafile and the file in the next
->, and the file which contains just one GenBank record, in the next


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 206
## A reader reports

(typical)) foreach{ ... } section of the parse1() subroutine, starting at
middle of page;
Most of the book's code is pretty clear & consistent, but one thing that the au
thor keeps wavering on is the inclusion or omission of spaces on lines like the
ones here. Appreviating, the code here has these lines:

} elseif( $in_sequence) {
} elseif ( $line =~ /^ORIGIN/ ) {
} else{

Note that the second elsif is followed by a space, but the first one isn't and
neither is the else. Likewise, $in_sequence has a leading space but not a trail
ing one.

## This report is correct. In this code fragment it does interfere with readability.
## Since the code is so dense here, I'd prefer:
if ( $line =~ /^//
/ ) {
}elseif ( $in_sequence ) {
}elseif ( $line =~ /^ORIGIN/ ) {
}else {
## But in general it's a deliberate choice to vary these things. 1) All such variations
## are legal Perl, and for good reason. 2) Beginners are likely to encounter such
## variations as they encounter different programming styles. 3) Beginners experiment
## with different styles as they develop their own preferences, so 4) I show the
## beginners different styles, and discuss the issue in the book.
## I am fully aware of the reason for standards for such formatting issues.
## However, I feel even in professional code they are not an unbreakable rule,
## and that readability is paramount. (You may feel that the only way to
## ensure readability is to follow a rule consistently, but I disagree.)


Page 207

like so: m!//
like so: m!^//
! where the expression is now ^//


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 208
+1 in program listing ## A reader reports


## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 208
+1 in program listing ## A reader reports

## This line should be deleted from the program listing.

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 208

in Examples 6-2 and 6-3
in Examples 8-2 and 8-3


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 208

Other methods of collecting annotation and sequence lines are possible, especially if
you go through the lines of the array more than once. You can scan through the
array, keeping track of the start-of-sequence and end-of-record line numbers, and
then go back and extract the annotation and sequence using an array splice (which
was described in the parseREBASE subroutine in Example 9-2). Here's an example:
Other methods of collecting annotation and sequence lines are possible, especially if
you go through the array more than once. If you first find the start-of-sequence
and end-of-record line numbers, you can do the extraction with an array slice, in
which you list the desired elements or indicate them with a range, for example:
@arrayslice = @array[0,3,5] or @arrayslice = @array[3..8]. Here we use a range:

## Note to Editor: "array slice" should be emphasized as a new term. If possible,
## it should be added to the index.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 209

so it extends the ^ and the $
to match after, or before, a newline, embedded in the string.
so it extends the ^ to match after an embedded newline,
and the $ to match before an embedded newline.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 209

First, let's examine
Let's examine


Note from the Author or Editor:
Error corrected. Will be fixed for the next printing.

Anonymous    May 02, 2011
Page 210

A call to read
After setting the input record separator to "//
", a call to read


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 219
Example 10-5 Subroutine "get_annotation_and_dna" at top of page ## A reader reports

# - given GenBank record, get annotation and DNA
# - given filehandle for GenBank file, get GenBank record

## This is confirmed. (N.B. This should only be changed at the top of the
## page, not on the second occurence of the line in the middle of the page.)


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 219
Example 10-5 Subroutine "get_annotation_and_dna"

$dna =~ s/[s/]//g;
!!!! Should be: !!!!
$dna =~ s/[s/d]//g;


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 223

which is a special variable pattern between
which is a special variable that remembers the pattern that matched between


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 227
1st paragraph

"I then saved the output as text in the file blst.txt, which is available from this..."
should be


Page 228

Example 10-8 finds
Example 10-7 finds


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 229

as this allows you to store, for instance, only one instance of an exon).
as a hash would allow you to store, for instance, only one value with key 'exon').


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 230

Example 10-8 gives the output:
Example 10-7 gives the output:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 231

parse_features of Example 10-8,
parse_features of Example 10-7,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 231

code of Example 10-8:
code of Example 10-7:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 235
middle of page; ## A reader reports

if ($offset)
if (defined $offset)

## $offset can have a valid zero value for the first accession number,
## which would fail the test for "if ($offset)"

## This report is confirmed. The book and the downloadable examples will be updated.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 239

the effect on biology and medicine would be profound.
the effect on biology and medicine will be profound.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 239

information form them.
information from them.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 241

Since you're running this program on a folder that contains PDB files,
this is what you'll see:
You can download a small sample 'pdb' directory from this book's web site;
if you do, this is what you'll see when you run this program:


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 242

you can give the directory name the special name "." for the current directory,
you can just call the directory by the special name ".",


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 242

the special files
the special file names


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 248

The reason for using a subroutine that you define is that it enables you
File::Find is designed to call your own subroutines, because it enables you


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 257
Example 11-5

Omit this line:
print "****chain $chain ****


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 258
20th line of code; ## A reader reports

given an scalar containing SEQRES lines,
given a scalar containing SEQRES lines,

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 260

In Chapter 10, I demonstrated two ways to parse GenBank files into sequence and
annotation and then how to parse the annotation into finer and finer levels of detail.
In Chapter 10, I compared two ways to parse GenBank files into sequence and
annotation, and to parse the annotation into finer and finer levels of detail.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 260

what field the input line was in.
which section of the file each input line came from.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 261

captures the pattern matched, denoted by $&
copies the pattern matched, denoted by the special variable $& that always holds
the last successful pattern match,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 261

Let's examine the subroutine extractSEQRES, now that the record types have been
parsed out, and extract the primary amino acid sequence.
Now that the record types have been parsed out, let's examine the subroutine extractSEQRES,
and see how it extracts the primary amino acid sequence.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 261

The previous parse, in Example 11-4,
The subroutine parsePDBrecordtypes, in Example 11-5,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 261

Our success with the previous parsePDBrecordtypes subroutine that used iteration
over lines (as opposed to regular expressions over multiline strings)
leads to the same approach here.
Our success in parsePDBrecordtypes using iteration over lines
(as opposed to regular expressions over multiline strings)
leads us to try the same approach here.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 262

you won't have use for the strings of amino acids in three-character codes.
you might not encounter strings of amino acids in three-character codes.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 265

and the element symbol.
and the element symbol. The $x, $y, and $z may also contain some spaces.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 265

1.888 -8.251 -2.511 N
18.955 -10.180 10.777 C
!!! Should be !!!
1.888 -8.251 -2.511 N
-0.873 9.368 16.046 C


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 266
+1 program code

printf "%8.3f%8.3f%8.3f %2s
", $x, $y, $z, $element;
print "$x $y $z $element


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 266

We've already seen the use of the printf function to format output with more
options then with the print function.
For column-specific data such as in PDB, an alternative with more options than
the print function is the printf function, which we'll see later in this chapter.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 266
-1 command example ## A reader reports

from the command line like so, assuming you saved the program
in a file called get_two_atoms:

%perl get_two_atoms pdb1a4O.ent
from the command line like so ("biocomp%" is the computer prompt), assuming you saved the program
in a file called get_two_atoms:

biocomp% perl get_two_atoms pdb/c1/pdb1c1f.ent

## This report is confirmed. The prompt has been explicitly noted.
## Also, the file name is now the same as in the preceding example.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267

Alternatively, on Unix or Linux or Mac OS X,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267
1st paragraph



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267
+1 program code

% cat pdb1a4O.ent | perl get_two_atoms


% perl get_two_atoms < pdb1a4O.ent
biocomp% cat pdb/c1/pdb1c1f.ent | perl get_two_atoms


coltrane% perl get_two_atoms < pdb/c1/pdb1c1f.ent


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267

Unix or Linux
Unix or Linux or Mac OS X


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267

Windows or Macintosh
Windows or older Macintosh


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267

a program that outputs a secondary structure report, called stride.
a program called stride that outputs a secondary structure report.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267
-1 ## A reader reports


## This report is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 267

of a PDB filename and collect the output in the subroutine call_stride that follows.
of a PDB filename. I collect the output in the subroutine call_stride that follows.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 270

The actual running of the program and collecting its output happens in just one line.
The actual running of the program and collecting its output happen in just one line.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 271
paragraphs +2 and +6

Move paragraph +2:

Using the subst function, the two for loops alter each line of the two arrays by saving
the 11th to the 60th positions of those strings. This is where the desired information

to the end of paragraph +6, which now reads:

Next, you want to save just those positions (or columns) of the lines that have the
sequence or structure information; you don't need the keywords, position numbers,
or the PDB entry name at the end of the lines. Using the subst function, the two for
loops alter each line of the two arrays by saving the 11th to the 60th positions.
This is where the desired information lies.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 272

Check the next section for a subroutine that will improve that output.
The exercises that follow ask you to write a subroutine that will improve that output.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 274

In biological research, the search for sequence similarity is very important. For
instance, a researcher who has discovered a potentially important DNA or protein
sequence wants to know if it's already been identified and characterized by another
researcher. If it hasn't, the researcher wants to know if it resembles any known
sequence from any organism. This information can provide vital clues as to the role
of the sequence in the organism.
In biological research, the search for sequence similarity is very important. For
instance, a researcher who has isolated a potentially important DNA or protein
sequence wants to know if it's already been identified and characterized by another
researcher. If it hasn't, the researcher wants to know if it resembles any known
sequence from any organism. This information can provide vital clues as to the role
of the sequence in the organism under study. And when no such resemblance is found,
it is evidence that the sequence may belong to a new class of genes or gene products.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 275

There are a several
There are several


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 285

so that you match all the available lines.
to match all available such lines (at least one).


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 288
code at bottom of page ## A reader reports

## This routine does not remove the characters "ct" from the word
## "Sbjct" found on each subject line. This causes the insertion
## of the "ct" preceding each subject line into the sequence
## returned in $subject. The value returned in $subject is always
## incorrect.

$query = join ( '' , ($HSP =~ /^Query.*
/gm) );

$subject = join ( '' , ($HSP =~ /^Sbjct.*
/gm) );
!!! Should be !!!
$query = join ( '' , ($HSP =~ /^Query(.*)
/gm) );

$subject = join ( '' , ($HSP =~ /^Sbjct(.*)
/gm) );

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 289
program output at top of page ## A reader reports

-> Subject String: ctggagatggctcagacctggaacctccggatgccggggacgacagcaagtctgagaatg

!!! Should be !!!

-> Subject String: ggagatggctcagacctggaacctccggatgccggggacgacagcaagtctgagaatggg

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 289

## Delete this sentence:

Here you see that not only can a subroutine return an array on a scalar value;
it can also return a hash.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 290

This is the nongreedy or minimal matching mentioned in Chapter 9.
This is the nongreedy or minimal matching; it matches the shortest string possible.
By default, * is greedy, matching the longest string possible.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 290

before and after embedded newlines.
before and after embedded newlines, respectively.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 290

the + following the other parentheses.
the + following the outer parentheses.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 291

in the same manner as you would a print function.
in the same manner as you would in a print function.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 291

Here's what is in Example 12-3.
Here's what is in the example just given.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 292

FORTRAN programming-language conventions
FORTRAN programming language conventions


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 294
+3 ## A reader reports confusion over the output on page 293, so I add on p.294

(which, in this case, is true.)
(in our example it prints "This DNA is so...")

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 295

Bioperl doesn't provide complete programs. Rather, it provides a fairly large-and
growing-set of modules for accomplishing common tasks, including some tasks
you've seen in this book. You're responsible for writing the code that holds the mod-
ules together. By providing these ready and (usually) easy-to-use modules, Bioperl
makes developing bioinformatics applications in Perl faster and easier. There are exam-
ple programs for most of the modules, which can be examined and modified to get
Bioperl doesn't provide the programmer with complete programs. Rather, it provides
a fairly large-and growing-set of modules for accomplishing common tasks, including
some tasks you've seen in this book. You have to write the programs that use the
modules. The goal of Bioperl is to make developing bioinformatics applications
easier, by providing easy-to-use standard modules. There are example
programs for most of the modules, which can be examined and modified to get


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 303

I've frequently mentioned modules and CPAN
I've frequently mentioned modules, and CPAN


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 305

the thousand of genes and gene products
the genes and gene products


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 305

Graphics programming language present
Graphics programming languages present


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 310
+5 ## A reader reports

"low signal-to-noise ration"
"low signal-to-noise ratio"

## This is confirmed.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 312



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 313



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 315

The Perl programs in this book start with the line:
The Perl programs in this book start with the line (with or without the -w):


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 315

If the Perl program file was called myprogram, and had executable permissions,
If the Perl program file is called myprogram, and has executable permissions,


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 318
+1 and +2

## The three instances of 1,000 should be changed. The comma is good
## Chicago Manual of Style, but incorrect Perl.



Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 322

(and if you're not careful, strings as well).
(and may give you unexpected results if you apply them to strings, as well).


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 323

(or a to b)
(or 'a' to 'b')


Note from the Author or Editor:
Error corrected. Will be fixed for next printing.

Anonymous    May 02, 2011
Page 325

instead of not or and.
instead of not, or, and.

## Also, the typesetting has made "not" and "and" in a special font, but
## has not done so for "or". All three should be in a special font.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 326

and in their variants and loops.
and their variants, and in loops.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 328

This shows that a pattern match can return a count of the number of translations made
in a string, which is then assigned to the variable $count.
This shows how a pattern match can return a count of the number of patterns found
in a string, which in this case is then assigned to the variable $count.


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 329

any variable name or none,
## The word 'none' is in a special font; it should be in normal font, as this
## is not a variable name


Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011
Page 332

Mac OS X

Note from the Author or Editor:
Error corrected. Will be fixed in next printing.

Anonymous    May 02, 2011