Errata

Can't download the examples and answers, Bro!

It seems to me that there is misunderstainig of how transcription occurs (DNA to RNA
or RNA to DNA). Will appreciate your feed-back.

Thanks
Hemant

# Perl: Exercise 4-5 Reverse Transcribing RNA into DNA

# The RNA
$RNA = 'ACGGGAGGACGGGAAAAUUACUACGGCAUUAGC';

print "
$RNA
";

# Transcribe RNA to DNA - Replace 'U' where there is 'T'.
# However, transcription occurs A -> T, U -> A, C -> G, G -> C
# So the correct answer is as below given the above RNA structure.

$DNA = $RNA;
$DNA =~ tr/ACGU/TGCA/;
print "
$DNA
";

# The correct DNA seq is TGCCCTCCTGCCCTTTTAATGATGCCGTAATCG

# The code below is incorrect

$DNA = $RNA;
$DNA =~ s/U/T/g;
print "
$DNA
";

# result is ACGGGAGGACGGGAAAATTACTACGGCATTAGC

exit;

When I ran example 6-4.pl after fixing the two bugs described in the text, the program
still did not generate the correct output. It seems that the variable
$receivingcommittment was never set to 1. It turned out that the variable name was
misspelt as "$recieving..." whereas it should be "$receiving...". Further correction
of the variable name would fix the problem.

there is no argument passed when the subroutine is called, therefore the printout
statement is always executed, even if the file doesn't exist
It should be :

if(file_passes_tests($file)) {
print "File $file exists, is a regular file, and is nonzero in size
";
}

In the answer of the exercise07.05, the subroutine mutate_codon says:


sub mutate_codon {

my($codon) = @_;

my @bases = qw(A C G T);

my $position = int rand 3;

my $base = $bases[$position];

my $newbase;

do {
$newbase = $bases[rand @bases];
} until ($newbase ne $base);

substr($codon, $position, 1) = $newbase;

return $codon;
}

which is not correct. If the author ran this exercise several times, he would realized that sometimes the result printed says

AAC mutates to AAC

The error comes in the line saying:

my $base = $bases[$position]; where the author uses $position to select the corresponding position in the codon... but he is using the array with the baes instead.

The correct subroutine should be:

sub mutate_codon {

my($codon) = @_;

my @bases = qw(A C G T);

my $position = int rand 3;

my $base = substr($codon,$position,1);

my $newbase;

do {
$newbase = $bases[rand @bases];
} until ($newbase ne $base);

substr($codon, $position, 1) = $newbase;

return $codon;
}

the following code in Example 10-2
($annotation, $dna) = ($record =~ /^(LOCUS.*ORIGINs*
)(.*)//
/s);

generates an error (uninitialized value <GBFILE> chunk 1) on my mac, using MacPerl

This code:

while ( $annotation =~ /^[A-Z].*
(^s.*
)*/gm)

generates a segmentation fault, when the code runs on
any real genbank file, such as hs_ref_chr22.gbs or
hs_ref_chr22.gbk

Example 10-6, Parsing GenBank Annotation, which begins on page 221, produces
incorrect results on pages 223 and 224. In particular, the parse_annotation()
subroutine does not check to see if the 'field' ($key:$value) it is about to store in
the hash table has already been stored. As a result, previous occurrences of a
particular field are clobbered and only the last occurrence is recorded. In the
example given, with the input taken from page 201, only the second "REFERENCE" field
is displayed (page 224).

Interestingly, the very next section on parsing the "FEATURES" table warns on page
228 about the possibility of running into this scenario when parsing the FEATURES
table's multiple fields - some of which have the same name. The same coding solution
should have been applied to the entire GenBank record.

.
..
3c
44
pdb1a4o.ent

->

.
..
3c
44
c1
c4
pdb1a4o.ent

Also, you have to make this change on p.243 244 246 247