Skip to Content
Python for Bioinformatics
book

Python for Bioinformatics

by Jason Kinser
June 2008
Beginner to intermediate
417 pages
10h 41m
English
Jones & Bartlett Learning
Content preview from Python for Bioinformatics

9 Tandem Repeats

Some regions of the genome contain repeating regions of DNA. In some cases the repeats are quite simple—for example, GATGATGAT. In other cases repeats are much more complicated, with regions repeating minor variations or sets of nested repeating regions. This chapter will explore one method of finding these repeating regions.

9.1 Tandem Repeats

Repeats are consecutive repeating segments in a string. Two simple examples are

 

TCTCTCTCATTCATTCATTC

A compressed format for representing the repeat is to place a subscript for the number of repeats of a substring enclosed in parentheses—for example, TGTGTGTG, which can be written as (TG)4.

Tandem repeats may become much more complex when a region repeats with a minor variation. In an ...

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.

Read now

Unlock full access

More than 5,000 organizations count on O’Reilly

AirBnbBlueOriginElectronic ArtsHomeDepotNasdaqRakutenTata Consultancy Services

QuotationMarkO’Reilly covers everything we've got, with content to help us build a world-class technology community, upgrade the capabilities and competencies of our teams, and improve overall team performance as well as their engagement.
Julian F.
Head of Cybersecurity
QuotationMarkI wanted to learn C and C++, but it didn't click for me until I picked up an O'Reilly book. When I went on the O’Reilly platform, I was astonished to find all the books there, plus live events and sandboxes so you could play around with the technology.
Addison B.
Field Engineer
QuotationMarkI’ve been on the O’Reilly platform for more than eight years. I use a couple of learning platforms, but I'm on O'Reilly more than anybody else. When you're there, you start learning. I'm never disappointed.
Amir M.
Data Platform Tech Lead
QuotationMarkI'm always learning. So when I got on to O'Reilly, I was like a kid in a candy store. There are playlists. There are answers. There's on-demand training. It's worth its weight in gold, in terms of what it allows me to do.
Mark W.
Embedded Software Engineer

You might also like

Mastering Python for Bioinformatics

Mastering Python for Bioinformatics

Ken Youens-Clark
Python Machine Learning - Third Edition

Python Machine Learning - Third Edition

Sebastian Raschka, Vahid Mirjalili
Python Workout

Python Workout

Reuven M. Lerner

Publisher Resources

ISBN: 9780763751869