book

Python for Bioinformatics

by Jason Kinser

June 2008

Beginner to intermediate

417 pages

10h 41m

English

Jones & Bartlett Learning

Read now

Unlock full access

1.1 The Purpose of This Book1.2 Use of Third-Party Software1.3 Required Background of Readers1.4 Object-Oriented Programming1.5 Presentation Convention1.6 Conversion from C/C++ to Python1.6.1 Similarities1.6.2 Fundamental Python Commands that Differ from C/C++1.7 The Environment1.8 BiopythonBibliography
2.1 Introduction to NumPy and SciPy2.2 Basic Array Manipulations2.3 Basic Math2.4 More on Multiplication2.5 More Math2.5.1 Equals or Copy2.5.2 Comparisons2.5.3 More on Slicing2.5.4 Sorting and Shaping2.5.5 Random Numbers2.5.6 Statistical Methods2.6 Thinking About Problems2.7 Array Conversions2.8 SciPy2.9 SummaryBibliographyProblems
3.1 The Image Module3.2 Colors and Conversions3.3 Digital Image Formats3.4 Simple Image Manipulations3.5 Conversions to and from Arrays3.6 SummaryBibliographyProblems

4.1 The Akando Module4.1.1 Plotting Routines4.1.2 Algebraic and Geometric Functions4.1.3 Correlation4.1.4 Image Conversions4.2 The Dancer Module4.3 SummaryProblems
5.1 Simple Statistics5.2 Distributions5.3 Normalization5.4 Multivariate Statistics5.5 Probabilities5.6 Odds5.7 Decisions from Distributions5.8 SummaryProblems
6.1 FASTA Files6.2 Genbank Files6.2.1 File Overview6.2.2 Parsing the DNA6.2.3 Gene and Protein Information6.2.4 Gene Locations6.2.5 Normal and Complement6.2.6 Splices6.2.7 Extracting All Gene Locations6.2.8 Coding DNA6.2.9 Proteins6.2.10 Extracting Translations6.3 ASN.1 File Format6.4 SummaryBibliographyProblems
7.1 Alphabets7.2 Matching Sequences7.2.1 Perfect Matches7.2.2 Insertions and Deletions7.2.3 Rearrangements7.2.4 Global Versus Local Alignments7.2.5 Sequence Length7.3 Simple Alignments7.3.1 Direct Alignment7.3.2 Statistical Alignment7.3.3 Brute Force Alignment7.4 SummaryBibliographyProblems
8.1 The Problem with the Brute Force Approach8.2 The Dynamic Programming Algorithm8.2.1 The Scoring Matrix8.2.2 The Arrow Matrix8.2.3 Extracting the Aligned Sequences8.3 Efficient Programming8.3.1 Flowing along the Diagonals8.3.2 Slicing Matrices8.3.3 Extracting Diagonal Element Locations8.3.4 Extracting Values from the Substitution Matrix8.3.5 Computing the Scoring Matrix Values for a Single Diagonal8.3.6 An Efficient Computation of the Scoring Matrix8.4 Global Versus Local Alignments8.5 Gap Penalties8.6 Does Dynamic Programming Find the Best Alignments?8.7 SummaryProblems
9.1 Tandem Repeats9.2 Hauth’s Solution9.2.1 Foundation9.2.2 Multiple Words9.2.3 Tandem Repeats9.3 SummaryBibliographyProblems
10.1 The Emission HMM10.2 The Transition HMM10.3 The Recurrent HMM10.4 Constructing a Transition HMM10.5 Considerations10.5.1 Assuming Data10.5.2 Spurious Strings10.5.3 Recurrent Probabilities10.6 SummaryProblems
11.1 Simulated Annealing11.2 The Genetic Algorithm11.2.1 Energy Surfaces11.2.2 The Genetic Algorithm Approach11.2.3 Checking the Solution11.3 Nonnumerical Genetic Algorithms11.3.1 Notes on Copying11.3.2 Creating Random Arrangements11.3.3 The Genetic Algorithm11.4 SummaryProblems
12.1 The Greedy Approach12.1.1 Sequence Comparison12.1.2 Assembly12.2 Nongreedy Approach12.2.1 Creating Genes12.2.2 Steps in the Genetic Algorithm12.2.3 The Test Run12.2.4 Improvements12.3 SummaryProblems
13.1 Theory of Gapped Alignments13.2 Chopping the Data13.3 Pairwise Alignments13.4 Building the Assembly13.4.1 Creating New Contigs13.4.2 Adding to a Contig13.4.3 Joining Contigs13.4.4 Performing the Assembly13.5 SummaryBibliographyProblems
14.1 Basic Tree Theory14.2 Python and Trees14.3 An Example Using UPGMA14.4 Examples of Trees14.4.1 Sorting Trees14.4.2 Dictionary Trees14.4.3 Percolation Trees14.4.4 Suffix Trees14.5 Decision Trees and Random Forests14.6 SummaryProblems
15.1 An Introduction to Text Mining15.2 Collecting Bioinformatic Textual Data15.3 Creating Dictionaries15.4 Methods of Finding Root Words15.4.1 Porter Stemming15.4.2 Suffix Trees15.4.3 Combining Simplified Porter Stemming with Slicing15.5 Document Analysis15.5.1 Text Mining Ten Documents15.5.2 Word Frequency15.5.3 Indicative Words15.5.4 Document Classification15.6 SummaryBibliographyProblems
16.1 Linguistic Complexity16.2 Suffix Trees16.3 Superstrings16.4 SummaryBibliographyProblems
17.1 The Purpose of Clustering17.2 k-Means Clustering17.3 Solving More Difficult Problems17.3.1 Preprocessing Data17.3.2 Modifications of k-Means17.4 Dynamic k-Means17.5 Comments on k-Means17.6 SummaryBibliographyProblems
18.1 SOM Theory18.2 An SOM Example18.2.1 Reading an Image18.2.2 Initializing the SOM18.2.3 The Best Matching Unit (BMU)18.2.4 Updating the SOM18.2.5 SOM Iterations18.2.6 Interpreting the SOM18.3 SummaryBibliographyProblems
19.1 The Purpose of PCA19.2 Eigenvectors19.3 The PCA Process19.3.1 Case 1: More Dimensions than Vectors19.3.2 Case 2: Linear Combinations in the Data19.3.3 Case 3: Imperfect Dimensionality Reductions19.3.4 Coordinate Selection19.4 Using SVD to Compute PCA19.5 Describing Systems with Eigenvectors19.6 Eigenimages19.7 SummaryBibliographyProblems
20.1 Data Collection20.2 The First Clustering20.3 Using Principal Component Analysis20.4 The Second Clustering20.5 Using a Self-Organizing Map20.6 SummaryBibliographyProblems
21.1 Fourier Theory21.2 Digital Fourier Transform21.2.1 DFT Theory21.2.2 Example with a Simple Sawtooth Signal21.2.3 Features of the DFT21.2.4 Power Spectrum21.3 Fast Fourier Transform21.3.1 Duplicate Computations21.3.2 The FFT Method21.3.3 FFTs in SciPy21.3.4 The Swap Function21.4 Frequency Analysis21.4.1 Simple Signals21.4.2 DNA Coding Regions21.5 SummaryBibliographyProblems
22.1 Correlation Theory22.2 Random Signal Correlation22.3 Structured Signal Correlation22.4 Correlation of DNA Strings22.5 Higher Dimensions22.5.1 Two-Dimensional FFTs in SciPy22.5.2 Image Frequencies22.6 The Onset of Image Processing22.7 Two-Dimensional CorrelationsSummaryBibliographyProblems
23.1 Alternate Encodings23.1.1 Hydrophobicity23.1.2 GC Content23.1.3 Numerical Methods23.2 Numerical Alignments23.3 Measuring the Hurst Exponent23.4 Chaos Representation23.4.1 Representing the Data23.4.2 A Simpler Method23.4.3 Comparing Chaos Images of Different Species23.4.4 Organizing the Data23.5 SummaryBibliographyProblems
24.1 Raw Data24.1.1 Reading Raw Data in Python24.1.2 Dealing with 16-Bit Data24.2 GEL Files24.2.1 TIFF Headers24.2.2 The Image File Directory24.2.3 Reading the Data24.3 SummaryBibliographyProblems
25.1 Spot Finding25.1.1 Intensity Variations25.1.2 Block Location25.1.3 The Coarse Grid25.1.4 Fine-Tuning the Spot Locations25.2 Spot Measurements25.3 SummaryBibliographyProblems
26.1 Reading Spreadsheets26.1.1 The Platform File26.1.2 The Z-Ratio File26.1.3 Reading Two Channel Files26.2 Displaying the Data26.2.1 The Heat Map26.2.2 The R Versus G Graph26.2.3 The R/G Versus I Graph26.2.4 M Versus A Graph26.3 SummaryBibliographyProblems
27.1 LOESS Normalization27.2 Expressed Genes27.3 Multiple Slides27.3.1 Normalization27.3.2 Extracting Outliers27.4 SummaryBibliographyProblems

Content preview from Python for Bioinformatics

9 Tandem Repeats

Some regions of the genome contain repeating regions of DNA. In some cases the repeats are quite simple—for example, GATGATGAT. In other cases repeats are much more complicated, with regions repeating minor variations or sets of nested repeating regions. This chapter will explore one method of finding these repeating regions.

9.1 Tandem Repeats

Repeats are consecutive repeating segments in a string. Two simple examples are

TCTCTCTCATTCATTCATTC

A compressed format for representing the repeat is to place a subscript for the number of repeats of a substring enclosed in parentheses—for example, TGTGTGTG, which can be written as (TG)₄.

Tandem repeats may become much more complex when a region repeats with a minor variation. In an ...

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.

Start your free trial

Bioinformatics with Python Cookbook - Third Edition

Publisher Resources

ISBN: 9780763751869

Python for Bioinformatics

by Jason Kinser

9 Tandem Repeats

9.1 Tandem Repeats

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.

You might also like

Bioinformatics with Python Cookbook - Third Edition

Bioinformatics Programming Using Python

Mastering Python for Bioinformatics

Deep Learning with Python

Publisher Resources

9 Tandem Repeats

9.1 Tandem Repeats

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,and much more.

You might also like

Bioinformatics with Python Cookbook - Third Edition

Bioinformatics Programming Using Python

Mastering Python for Bioinformatics

Deep Learning with Python

Publisher Resources

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.