Skip to Content
Python für die Bioinformatik beherrschen
book

Python für die Bioinformatik beherrschen

by Ken Youens-Clark
October 2024
Intermediate to advanced
456 pages
11h 48m
German
O'Reilly Media, Inc.
Content preview from Python für die Bioinformatik beherrschen

Kapitel 2. Transkription von DNA in mRNA: Strings mutieren, Dateien lesen und schreiben

Diese Arbeit wurde mithilfe von KI übersetzt. Wir freuen uns über dein Feedback und deine Kommentare: translation-feedback@oreilly.com

Um die Proteine zu bilden, die für die Erhaltung des Lebens notwendig sind, müssen Bereiche der DNA in eine Form von RNA umgeschrieben werden, die Boten-RNA (mRNA) genannt wird. Es gibt zwar viele faszinierende biochemische Unterschiede zwischen DNA und RNA, aber für unsere Zwecke besteht der einzige Unterschied darin, dass alle Buchstaben T, die für die Base Thymin in einer DNA-Sequenz stehen, in den Buchstaben U, für Uracil, geändert werden müssen. Wie auf der Rosalind RNA-Seite beschrieben, wird das Programm, das ich dir zeigen werde, wie du es schreibst, eine DNA-Sequenz wie ACGT akzeptieren und die transkribierte mRNA ACGU ausgeben. Ich kann die Funktion str.replace() von Python verwenden, um dies in einer Zeile zu erledigen:

>>> 'GATGGAACTTGACTACGTAAATT'.replace('T', 'U')
'GAUGGAACUUGACUACGUAAAUU'

Du hast bereits in Kapitel 1 gesehen, wie man ein Programm schreibt, das eine DNA-Sequenz von der Kommandozeile oder aus einer Datei entgegennimmt und ein Ergebnis ausgibt. Ich werde dieses Programm interessanter machen, indem ich ein sehr häufig vorkommendes Muster in der Bioinformatik aufgreife. Ich werde nämlich zeigen, wie man eine oder mehrere Eingabedateien verarbeitet und die Ergebnisse in ein Ausgabeverzeichnis stellt. Es ist zum Beispiel üblich, die Ergebnisse ...

Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.

Read now

Unlock full access

More than 5,000 organizations count on O’Reilly

AirBnbBlueOriginElectronic ArtsHomeDepotNasdaqRakutenTata Consultancy Services

QuotationMarkO’Reilly covers everything we've got, with content to help us build a world-class technology community, upgrade the capabilities and competencies of our teams, and improve overall team performance as well as their engagement.
Julian F.
Head of Cybersecurity
QuotationMarkI wanted to learn C and C++, but it didn't click for me until I picked up an O'Reilly book. When I went on the O’Reilly platform, I was astonished to find all the books there, plus live events and sandboxes so you could play around with the technology.
Addison B.
Field Engineer
QuotationMarkI’ve been on the O’Reilly platform for more than eight years. I use a couple of learning platforms, but I'm on O'Reilly more than anybody else. When you're there, you start learning. I'm never disappointed.
Amir M.
Data Platform Tech Lead
QuotationMarkI'm always learning. So when I got on to O'Reilly, I was like a kid in a candy store. There are playlists. There are answers. There's on-demand training. It's worth its weight in gold, in terms of what it allows me to do.
Mark W.
Embedded Software Engineer

You might also like

Blaupausen für Textanalyse mit Python

Blaupausen für Textanalyse mit Python

Jens Albrecht, Sidharth Ramachandran, Christian Winkler

Publisher Resources

ISBN: 9798341605442