July 2003
Intermediate to advanced
368 pages
13h 44m
English
Content preview from BLAST
Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
O’Reilly covers everything we've got, with content to help us build a world-class technology community, upgrade the capabilities and competencies of our teams, and improve overall team performance as well as their engagement.I wanted to learn C and C++, but it didn't click for me until I picked up an O'Reilly book. When I went on the O’Reilly platform, I was astonished to find all the books there, plus live events and sandboxes so you could play around with the technology.I’ve been on the O’Reilly platform for more than eight years. I use a couple of learning platforms, but I'm on O'Reilly more than anybody else. When you're there, you start learning. I'm never disappointed.I'm always learning. So when I got on to O'Reilly, I was like a kid in a candy store. There are playlists. There are answers. There's on-demand training. It's worth its weight in gold, in terms of what it allows me to do.
This is the Title of the Book, eMatter Edition
Copyright © 2012 O’Reilly & Associates, Inc. All rights reserved.
118
|
Chapter 8: 20 Tips to Improve Your BLAST Searches
8.4 View BLAST Reports Graphically
BLAST reports can be complicated. Viewing them graphically can help you under-
stand them better, especially when the reports are very long. Appendix D includes a
simple Perl program that converts tabular output from NCBI-BLAST reports into a
GIF, PNG, or JPEG image. Figures 8-2, 8-4, 8-8, and 8-9 were created with this pro-
gram. Appendix E contains a program that converts the standard BLAST reports to
the NCBI tabular format. The programs are available at this book’s O’Reilly web
site.
Figure 8-2 is an example of a BLASTX search. Appendix D contains more informa-
tion on the display.
Figure 8-1. Searching (a) an ALU element and (b) a shuffled version against the C. elegans genome
Figure 8-2. A graphical view of a BLASTX report
Score = 36.5 bits (22), Expect = 0.28
Identities = 57/88 (64%), Gaps = 9/88 (10%)
Strand = Plus / Minus
Query: 115 tctacaaaaaatacaaaaattagccg-ggcgt--ggtggcg--cgcgcctgtagtcccag 169
||||||||||| | || |||||| || || ||| ||| | ||| | || ||||
Sbjct: 66749 tctacaaaaaacagaataattagacgcaaagtccggtagcggcctcgcacgacgttccag 66690
Query: 170 ctactcgggaggctgaggcaggaggatc 197
|| ||| || ||||| || ||
Sbjct: 66689 ct----gggcatttggagcaggtggttc 66666
Score = 42.9 bits (26), Expect = 0.003
Identities ...
Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.
Read now
Unlock full access
More than 5,000 organizations count on O’Reilly
O’Reilly covers everything we've got, with content to help us build a world-class technology community, upgrade the capabilities and competencies of our teams, and improve overall team performance as well as their engagement.Julian F.
I wanted to learn C and C++, but it didn't click for me until I picked up an O'Reilly book. When I went on the O’Reilly platform, I was astonished to find all the books there, plus live events and sandboxes so you could play around with the technology.Addison B.
I’ve been on the O’Reilly platform for more than eight years. I use a couple of learning platforms, but I'm on O'Reilly more than anybody else. When you're there, you start learning. I'm never disappointed.Amir M.
I'm always learning. So when I got on to O'Reilly, I was like a kid in a candy store. There are playlists. There are answers. There's on-demand training. It's worth its weight in gold, in terms of what it allows me to do.