Skip to Content
BLAST
book

BLAST

by Ian Korf, Mark Yandell, Joseph Bedell
July 2003
Intermediate to advanced
368 pages
13h 44m
English
O'Reilly Media, Inc.
Content preview from BLAST
This is the Title of the Book, eMatter Edition
Copyright © 2012 O’Reilly & Associates, Inc. All rights reserved.
Command-Line Tutorial
|
185
You should see the following output:
>AU109017 AU109017 Caenorhabditis elegans cDNA clone:yk701g7 : 5' end, single read.
TGGCCTACTGGGGTTTAATTACCCAAGTTTGAGATGGCTGCTGCTTCAGTGAAAGGCTTT
TTCCAGCGGACCGGAATCAGCATCAAAGAATATTTTAAACGAATGGGAAATGATTATGCT
ACTGTAGCTAGGGAAACTGTCCAAGGATGTAAAGATAGACCTGTTAAAGCTGGAGTTGTT
TTCTCTGGGCTCGGTTTTTTAACCTATGCATATCAGACAAATCCAACAGAGCTGGAAATG
TATGATTATTTATGCGAGAGACGACAAAAGTTAGTTTTGGTCCCGAATTCTGAGCATAAT
CCGGCTACAACTAAAGAATTAACTGCTCGCGA
And for proteins, you can rely on a similar action:
xdget -p globins HBP_CANLI
You should see the following output:
>HBP_CANLI P42511 Leghemoglobin.
MGAFSEKQESLVKSSWEAFKQNVPHHSAVFYTLILEKAPAAQNMFSFLSNGVDPNNPKLK
AHAEKVFKMTVDSAVQLRAKGEVVLADPTLGSVHVQKGVLDPHFLVVKEALLKTFKEAVG
DKWNDELGNAWEVAYDELAAAIKKAMGSA
nrdb and patdb
The nrdb and patdb programs are useful for removing the redundant sequences you
saw earlier. Use nrdb first:
nrdb globins > globins_nr
The additional output from the program is as follows:
--------- Records --------- -------------- Residues -----------
Database Read Duplicate Written Read Duplicate Written
globins 1203 39 1164 211,084 37,819 173,265
Totals: 1203 39 1164 211,084 37,819 173,265
No. of base word hits: 53 (53 total)
No. of 32-bit hash hits: 39
Total memory allocated: 0.500 MB
Longest comment line ...
Become an O’Reilly member and get unlimited access to this title plus top books and audiobooks from O’Reilly and nearly 200 top publishers, thousands of courses curated by job role, 150+ live events each month,
and much more.

Read now

Unlock full access

More than 5,000 organizations count on O’Reilly

AirBnbBlueOriginElectronic ArtsHomeDepotNasdaqRakutenTata Consultancy Services

QuotationMarkO’Reilly covers everything we've got, with content to help us build a world-class technology community, upgrade the capabilities and competencies of our teams, and improve overall team performance as well as their engagement.
Julian F.
Head of Cybersecurity
QuotationMarkI wanted to learn C and C++, but it didn't click for me until I picked up an O'Reilly book. When I went on the O’Reilly platform, I was astonished to find all the books there, plus live events and sandboxes so you could play around with the technology.
Addison B.
Field Engineer
QuotationMarkI’ve been on the O’Reilly platform for more than eight years. I use a couple of learning platforms, but I'm on O'Reilly more than anybody else. When you're there, you start learning. I'm never disappointed.
Amir M.
Data Platform Tech Lead
QuotationMarkI'm always learning. So when I got on to O'Reilly, I was like a kid in a candy store. There are playlists. There are answers. There's on-demand training. It's worth its weight in gold, in terms of what it allows me to do.
Mark W.
Embedded Software Engineer

You might also like

INSPIRED

INSPIRED

Marty Cagan
The Goal

The Goal

Eliyahu M. Goldratt, Jeff Cox

Publisher Resources

ISBN: 0596002998Catalog PageErrata